Stem-loop sequence mtr-MIR2652c

AccessionMI0011973 (change log)
DescriptionMedicago truncatula miR2652c stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   g  gu            c                                       -  -    aca     caaaaaccauuuucccaauaaaaugguuuuugcauaauuuu 
5'  cg  uaugguguauaa gaaauccuuaugcacccugcauaaauucagaaaugguuu ug gagu   acuua                                         a
    ||  |||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||   |||||                                          
3'  gc  auaucacguauu cuuuaggaauacgugggacguauuuaggucuuuaccaaa ac cuca   ugaau                                         u
   -  ug            c                                       u  a    aca     uacgaaaggucaugagacguauuccuaaaggucguggaacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 12812990-12813216 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2652c
mtr-MIR2652cchr2: 12812990-12813216 [-]
mtr-MIR2652dchr2: 12812989-12813215 [+]
Database links

Mature sequence mtr-miR2652c

Accession MIMAT0013426
Sequence

188 - 

uaugcagggugcauaaggauu

 - 208

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).