Stem-loop sequence mtr-MIR2652d

AccessionMI0011974 (change log)
DescriptionMedicago truncatula miR2652d stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   g  ac   a   c    g                          c           uaugugaguuguacuuaaugcuuuccaguacucugcauaaggauuuccagcaccuug 
5'  cg  uau gug auaa gaaauccuuaugcacccugcauaaau cagaaaugguu                                                         c
    ||  ||| ||| |||| |||||||||||||||||||||||||| |||||||||||                                                          
3'  gc  aua cac uauu cuuuaggaauacgugggacguauuua gucuuuaccaa                                                         a
   -  ca   c   a    g                          a           aaccucauguugaauguuuuugguaaaaggguuauuuuaccaaaaacguauuaaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 12812989-12813215 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2652d
mtr-MIR2652dchr2: 12812989-12813215 [+]
mtr-MIR2652cchr2: 12812990-12813216 [-]
Database links

Mature sequence mtr-miR2652d

Accession MIMAT0013427
Sequence

188 - 

uaugcagggugcauaaggauu

 - 208

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).