Stem-loop sequence mtr-MIR2652e

AccessionMI0011975 (change log)
DescriptionMedicago truncatula miR2652e stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   g  a                                         cagaaaugauuuuggaguacaacucacauaaaucauuuccacagcaaaaugguuuugacauaauuuuaugcagggugc 
5'  cg uuauggugcauaaggaaauccuuaugcacccugcauaaauc                                                                              u
    || |||||||||||||||||||||||||||||||||||||||||                                                                               
3'  gc aauaccacguauucuuuuaggaauacgugggacguauuuag                                                                              g
   -  c                                         aucuuuaccaaagacacucaacaugaaguuuugguaaucuacaugaaguaccaaaagucgugguacguauuccuaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 31385772-31386018 [+]
intergenic
Database links

Mature sequence mtr-miR2652e

Accession MIMAT0013428
Sequence

208 - 

uaugcagggugcauaaggauu

 - 228

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).