Stem-loop sequence mtr-MIR2652f

AccessionMI0011976 (change log)
DescriptionMedicago truncatula miR2652f stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   u uu   aau          -      aa  aaaa      aguacaucuaaugauuuuggaguacaacucacagaaaccauuuccacugcaaa 
5'  g  uuc   ugcacccugc uggauc  ag    ccauua                                                     a
    |  |||   |||||||||| ||||||  ||    ||||||                                                      
3'  c  agg   acgugggacg auuuag  uc    gguaau                                                     u
   c uu   aau          u      gg  ---g      acgguuuugauaaaacgucacuuuuaucaaaaacacucaaccugagauuuugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 34904296-34904481 [+]
intergenic
Database links

Mature sequence mtr-miR2652f

Accession MIMAT0013429
Sequence

164 - 

uaugcagggugcauaaggauu

 - 184

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).