Stem-loop sequence mtr-MIR2652g

AccessionMI0011977 (change log)
DescriptionMedicago truncatula miR2652g stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   u     c                                    cc       a   c  u   c    -   -  -        --agau    uu        cc    ---cucu  auaa 
5'  gguua ggugcauaaggaaauucuuaugcacccugcauaaau  agaaaug uuu ug gag ugua cuc ca aaaccauu      guaa  aaugguuu  agca       gc    a
    ||||| ||||||||||||||||||||||||||||||||||||  ||||||| ||| || ||| |||| ||| || ||||||||      ||||  ||||||||  ||||       ||     
3'  ccaau ccacguauucuuuuaggaauacgugggacguauuua  ucuuuac aaa ac cuc auau gag gu uuugguaa      cguu  uuaccaaa  ucgu       cg    u
   g     a                                    aa       c   -  -   -    u   u  c        agguau    --        -a    auuaacc  accu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 38127389-38127622 [+]
intergenic
Database links

Mature sequence mtr-miR2652g

Accession MIMAT0013430
Sequence

195 - 

uaugcagggugcauaaggauu

 - 215

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).