Stem-loop sequence mtr-MIR2652h

AccessionMI0011978 (change log)
DescriptionMedicago truncatula miR2652h stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   u                     a                        a      -a     -    acaacacacagaaaccauuuccauagcaaaauaguuuuggcauaauuuuauguaaggug 
5'  gcgguuaugguguauaaggaa ucuuuaugcacccugcauaaauuc gaaaug  uuuug gagu                                                           c
    ||||||||||||||||||||| |||||||||||||||||||||||| ||||||  ||||| ||||                                                            
3'  cgccaauaccacguauuccuu aggaauacgugggacguauuuagg cuuuac  aagac cuca                                                           u
   -                     -                        c      ca     a    acaugaaguuuugguaaucuacaugaauuaccaaaggucgugggacguauuccuaaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 7029666-7029913 [+]
intergenic
Database links

Mature sequence mtr-miR2652h

Accession MIMAT0013431
Sequence

209 - 

uaugcagggugcauaaggauu

 - 229

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).