Stem-loop sequence mtr-MIR2652j

AccessionMI0011980 (change log)
DescriptionMedicago truncatula miR2652j stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   a  a      uuuu   -    a                                       --g    acaauucagaaaccauuuccacagcaaaaugguuuugauauaauuuu 
5'  gc ugguuu    ugu ugag aaauccuuaugcacucugcauaaauccagaaaugguuuu   gagu                                               a
    || ||||||    ||| |||| |||||||||||||||||||||||||||||||||||||||   ||||                                                
3'  cg gccaaa    acg auuc uuuaggaauacgugggacguauuuaggucuuuacuaaaa   cuca                                               u
   -  c      ----   u    c                                       aca    acauaaaguuuuaguaaucuacaugaauuaucaaaugucgugggacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 17937327-17937552 [-]
intergenic
Database links

Mature sequence mtr-miR2652j

Accession MIMAT0013433
Sequence

187 - 

uaugcagggugcauaaggauu

 - 207

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).