Stem-loop sequence mtr-MIR2652k

AccessionMI0011981 (change log)
DescriptionMedicago truncatula miR2652k stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   -gguuacc                         -            a            ---ag    a   a  uagaccauuuucacaucaaaauaguuuuggcauaauuggguug 
5'         gugcauaaggaaauccuuaugcacu ugcauaaaucua aaaugguuuugg     ugua cuc ca                                           g
           ||||||||||||||||||||||||| |||||||||||| ||||||||||||     |||| ||| ||                                           g
3'         cacguauuccuuuaggaauacgugg acguauuuagau uuuaccaaaauc     acau gag gu                                           a
   caauauac                         g            a            acuua    -   -  uuuaguaaucuacauaaauuaccaaaggucgugggacguauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 43002052-43002283 [-]
intergenic
Database links

Mature sequence mtr-miR2652k

Accession MIMAT0013434
Sequence

193 - 

uaugcagggugcauaaggauu

 - 213

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).