Stem-loop sequence mtr-MIR2652l

AccessionMI0011982 (change log)
DescriptionMedicago truncatula miR2652l stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   g        a                                                --g    acaacucacgaaaaccauuuuuauagcaaaaugguuuuggcauaauuu 
5'  cgguuaug ugcauaaggaaaucuuuaugcacucugcauaaaucuagaaaugguuuu   gagu                                                u
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||   ||||                                                 
3'  gccaauac acguauuccuuuaggaauacgugggacguauuuaggucuuuaccaaag   cuca                                                a
   -        c                                                aca    acaugagguuuugguaaucuauaugaauuaccaaaggucgugggacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 45334580-45334804 [+]
intergenic
Database links

Mature sequence mtr-miR2652l

Accession MIMAT0013435
Sequence

186 - 

uaugcagggugcauaaggauu

 - 206

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).