Stem-loop sequence mtr-MIR2655a

AccessionMI0011987 (change log)
DescriptionMedicago truncatula miR2655a stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -   a       u       c                              u                                              a  ga  aaacuaau   a   a   a   -ua  gga 
5'  ccc uaaguaa aaaaggu cguuuaggucccuuaacuuuauuuaaagua cgguuugguccuuucuguuaauuuaauucaaaaaaacguuaaguuu gg  cc        acu auu aau agu   ag   c
    ||| ||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||  ||        ||| ||| ||| |||   ||    
3'  ggg auuuauu uuuuuca gcaaauccagggaauugaaauaaauuucau gccaaaccagggaagacaauuaaauuaaguuuuuuugcaauuuaaa cc  gg        uga uaa uua uca   uc   c
   a   a       u       a                              u                                              a  ag  -----aau   a   a   a   uaa  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 40642836-40643102 [+]
intergenic
Database links

Mature sequence mtr-miR2655a

Accession MIMAT0013440
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).