Stem-loop sequence mtr-MIR2655b

AccessionMI0011988 (change log)
DescriptionMedicago truncatula miR2655b stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   cc    u                 g                 c   c                           a   --u    ccuuaucuuauuu              ----u   cc 
5'   guuu ggucccuuaacuuuauu aaaguaucgguuugguc uuu uguuaauuuaauucaaaaaaacguuaa uuu   gauc             aauuaguauuaguu     ggu  c
     |||| ||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||| |||   ||||             ||||||||||||||     |||   
3'   caaa ccagggaauugaaauaa uuucauagccaaacuag aaa acaauuaaauuaaguuuuuuugcaauu aaa   cugg             uugauuaugauuaa     uca  u
   --    u                 a                 -   u                           c   ucc    ------------u              uuuau   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 18275180-18275404 [+]
intergenic
Database links

Mature sequence mtr-miR2655b

Accession MIMAT0013441
Sequence

2 - 

cguuuuggucccuuaacuuua

 - 22

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).