Stem-loop sequence mtr-MIR2655c

AccessionMI0011989 (change log)
DescriptionMedicago truncatula miR2655c stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   c  u                     a g             u u     a  a     a         a         -    a   ca        a  gaccaaacuaauauuaauuaaauaaguuaagg 
5'  cc uaaguaauaaaagguccguuu g ucccuuaacuuua u aaagu uc guuug uccuuucug uaauuuaau uaaa aaa  uuaaguuu gg                                g
    || ||||||||||||||||||||| | ||||||||||||| | ||||| || ||||| ||||||||| ||||||||| |||| |||  |||||||| ||                                 
3'  gg auucauuauuuuccaggcaaa c agggaauugaaau a uuuca ag caaac aggaaagau auuaaauua guuu uuu  aauuuaaa cc                                a
   a  u                     a g             c c     c  c     c         a         a    a   uc        a  agagaauagaauaaauuaaccauaaucaaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 20434620-20434884 [+]
intergenic
Database links

Mature sequence mtr-miR2655c

Accession MIMAT0013442
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).