Stem-loop sequence mtr-MIR2655d

AccessionMI0011990 (change log)
DescriptionMedicago truncatula miR2655d stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                                                    a                          c       c        ga  gaccaaa   au   a   a   a   -ua  gga 
5'  cccauaaguaauaaaaaguccguuuaggucccuuaacuuuauuuaaaguauc guuugguccuuucuguuaauuuaauu aaaaaaa guuaaguu  gg       uua  acu auu aau agu   ag   c
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||  ||       |||  ||| ||| ||| |||   ||    
3'  ggguauucauuauuuuucaggcaaauccagggaauugaaauaaauuucauag caaaccaggaaagacaauuaaauuaa uuuuuuu caauuuaa  cc       aau  uga uaa uua uca   uc   c
   a                                                    c                          a       a        aa  ---agag   --   a   a   a   uaa  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 23673623-23673889 [+]
intergenic
Database links

Mature sequence mtr-miR2655d

Accession MIMAT0013443
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).