Stem-loop sequence mtr-MIR2655e

AccessionMI0011991 (change log)
DescriptionMedicago truncatula miR2655e stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                    c    a       u         u    uaucgguuugauccuuucuguuaauuuaauucaaaaaaaauguuaaguuuagggacca 
5'  uccauaaguaauaaaagguc guuu ggucccu aacuuuauu aaag                                                          a
    |||||||||||||||||||| |||| ||||||| ||||||||| ||||                                                           
3'  ggguauucauuauuuuccag caaa ccgggga uugaaauaa uuuu                                                          a
   a                    a    a       u         u    uuaaauuaaguuuuuuguacaauuuaaaacuagggaauagaauaaauuaaucauaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 13982332-13982546 [+]
intergenic
Database links

Mature sequence mtr-miR2655e

Accession MIMAT0013444
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).