Stem-loop sequence mtr-MIR2655f

AccessionMI0011992 (change log)
DescriptionMedicago truncatula miR2655f stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                                               a   c   c                   c           c         agagaccaaacuaauacuaauuaaauaaguuaag 
5'  cccauaaguaauaaaagguccguuuaggucccuuaacuuuauuuaaa uau ggu ugguccuuuuuguuaauuu auucaaaaaaa guuaaguuu                                  g
    ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||| ||||||||||| |||||||||                                  g
3'  ggguauucauuauuuuccaggcaaauccagggaauugaaguaaauuu aua cca accaggaaagacaauuaaa uaaguuuuuuu caauuuaaa                                  a
   a                                               c   a   a                   u           a         accagggaauugaauaaauuaaucauaucaaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 11522984-11523249 [-]
intergenic
Database links

Mature sequence mtr-miR2655f

Accession MIMAT0013445
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).