Stem-loop sequence mtr-MIR2655g

AccessionMI0011993 (change log)
DescriptionMedicago truncatula miR2655g stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -   a            a        a                        u      a       a             c     a           agggaccaaacuaauacuaauuaaauaaguuaagg 
5'  cuc uaaguaauaaaa guccguuu ggucccuuaacuuuauuuaaagua cgguuu guccuuu uguuaauuuaauu aaaaa acguuaaguuu                                   g
    ||| |||||||||||| |||||||| |||||||||||||||||||||||| |||||| ||||||| ||||||||||||| ||||| |||||||||||                                    
3'  ggg auucauuauuuu caggcaaa cuagggaauugaaauaaauuucau gucaaa cagggaa acaauuaaauuaa uuuuu ugcaauuuaaa                                   a
   a   a            c        a                        u      c       g             -     a           accagagaauugaauaaauuaaucauaaucaaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 35510189-35510454 [-]
intergenic
Database links

Mature sequence mtr-miR2655g

Accession MIMAT0013446
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).