Stem-loop sequence mtr-MIR2655h

AccessionMI0011994 (change log)
DescriptionMedicago truncatula miR2655h stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   c                        a                 u       ca     a  a   a             a       c         a   a  aaacuaauacua 
5'  ucauaaguaauaaaagguccguuu ggucccuuaacuuuauu aaaguau  guuug uc uuu uguuaauuuaauu aaaaaaa guuaaguuu uga cc            a
    |||||||||||||||||||||||| ||||||||||||||||| |||||||  ||||| || ||| ||||||||||||| ||||||| ||||||||| ||| ||            u
3'  gguauuuauuauuuuccaggcaaa ucagggaauugaaauaa uuucaua  caaac ag aaa acaauuaaauuaa uuuuuuu caauuuaaa acu gg            u
   a                        a                 c       ac     c  g   g             a       a         -   a  gaauagaauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 17456062-17456295 [+]
intergenic
Database links

Mature sequence mtr-miR2655h

Accession MIMAT0013447
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).