Stem-loop sequence mtr-MIR2655i

AccessionMI0011995 (change log)
DescriptionMedicago truncatula miR2655i stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -        u            g        cc            a      ua        a                u      -----------            a  gaccaaacuaauacuaauuaaauaagcuaagg 
5'  cccauaag aauaaaaggucc uuuagguc  uuaacuuuauuu aaguau  guuugguc uuucuguuaauuuaau caaaaa           aacguuaaguuu gg                                g
    |||||||| |||||||||||| ||||||||  |||||||||||| ||||||  |||||||| |||||||||||||||| ||||||           |||||||||||| ||                                 
3'  ggguauuc uuauuuuccagg aaauccag  aauugaaauaaa uucaua  caaaccag gaagacaauuaaauua guuuuu           uugcaauuuaaa cc                                a
   a        u            g        -a            g      gc        g                c      aauuguuuuuu            a  agcgaauugaauaaauuaaucauaauuaaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 11020308-11020584 [-]
intergenic
Database links

Mature sequence mtr-miR2655i

Accession MIMAT0013448
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).