Stem-loop sequence mtr-MIR2655j

AccessionMI0011996 (change log)
DescriptionMedicago truncatula miR2655j stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -   c                   uua     c           u              a        a                            uagcgaccaaauuaauacuaauugaauaaguuaagg 
5'  ccu uaaguaauaaaagguccgu   ggucc uuaacuuuauu aaaguaucgguuug uccuuucu uuaauuuaauucaaaaaaauguuaaguu                                    g
    ||| |||||||||||||||||||   ||||| ||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||                                     
3'  ggg auucauuauuuuccaggca   ccagg aauugaaauaa uuucauagucaaac aggaaaga aauuaaauuaaguuuuuuuacaauuuaa                                    a
   a   u                   uaa     a           c              c        c                            aaccagggaauagaauaaauuaaucauaaucaaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 12695849-12696115 [+]
intergenic
Database links

Mature sequence mtr-miR2655j

Accession MIMAT0013449
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).