Stem-loop sequence mtr-MIR2655k

AccessionMI0011997 (change log)
DescriptionMedicago truncatula miR2655k stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                               c    c       u            a   a   a                    g  u       a  ga gaaa  aau   a   a   a   uaag   c 
5'  cucauaaguaauaaaagguucguuuaggucc uuaa uuuauuu aaguaucgguuu auc uuu uguuaauuuaauucaaaaaa cg uaaguuu gg  c    cu   acu auu aau agu    gga c
    ||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| ||| ||| |||||||||||||||||||| || ||||||| ||  |    ||   ||| ||| ||| |||    |||  
3'  ggguauucauuauuuuucaagcaaauccagg aauu aaauaaa uucauagccaaa uag aaa auaauuaaauuaaguuuuuu gc guucaaa cc  g    ga   uga uaa uua uca    ucu a
   a                               a    a       u            c   a   g                    -  c       a  ag ----  -au   a   a   a   -caa   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 20298253-20298518 [-]
intergenic
Database links

Mature sequence mtr-miR2655k

Accession MIMAT0013450
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).