Stem-loop sequence mtr-MIR2655l

AccessionMI0011998 (change log)
DescriptionMedicago truncatula miR2655l stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -   a            aaac     a     c                  u                                              ag  a  aaa  aau   a   a   a   -ua   aa 
5'  ccc uaaguaauaaaa    cguuu ggucc uuaacuuuauuuaaagua cgguuugguccuuucuguuaauuuaauucaaaaaaacguuaaguuu  gg cc   cu   acu auu aau agu   agu  c
    ||| ||||||||||||    ||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||  || ||   ||   ||| ||| ||| |||   |||   
3'  ggg auucauuauuuu    gcaaa ccagg aauugaaauaaauuucau gccaaaccagggaagauaauuaaauuaaguuuuuuugcaauuuaaa  cc gg   ga   uga uaa uua uca   uca  c
   a   a            ccaa     a     -                  u                                              -a  -  --g  -au   a   a   a   uaa   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 14236286-14236551 [-]
intergenic
Database links

Mature sequence mtr-miR2655l

Accession MIMAT0013451
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).