Stem-loop sequence mtr-MIR2655m

AccessionMI0011999 (change log)
DescriptionMedicago truncatula miR2655m stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -       uc        aucc    a                u        cgguuug   cc  u                               a aa  aagcuaau   a   a   a   uaa  ga 
5'  uucauaa  aauaaaag    guuu ggucccuuaacuuuau uaaaguau       guc  uu uguugauuuaauucaaaaaaacguuaaguuu g  cc        acu auu aau agu   gg  a
    |||||||  ||||||||    |||| |||||||||||||||| ||||||||       |||  || ||||||||||||||||||||||||||||||| |  ||        ||| ||| ||| |||   ||   
3'  ggguauu  uuauuuuc    caaa cuagggaauugaaaua auuucaua       cag  aa acaauuaaauuaaguuuuuuugcaauuuaaa c  gg        uga uaa uua uca   uc  c
   a       ua        caua    c                u        -----aa   ua  u                               a ca  ----gaau   c   a   a   uaa  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 18553085-18553344 [+]
intergenic
Database links

Mature sequence mtr-miR2655m

Accession MIMAT0013452
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).