Stem-loop sequence mtr-MIR2655n

AccessionMI0012000 (change log)
DescriptionMedicago truncatula miR2655n stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -cc             cu  c                       u              a                            c     c   a  ga  aaacuaauacua 
5'    cauaaguaaugaa  gu cguuuaggucccuuaacuuuauu aaaguaucgguuug uccuuucuguuaauuuaauucaaaaaaa guuaa uuu gg  cc            a
      |||||||||||||  || ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||| ||| ||  ||             
3'    guauucauuauuu  ca gcaaauccagggaauugaaauaa uuucauagucaaac aggaaagacaauuaaauuaaguuuuuuu caauu aaa cc  gg            u
   aga             uc  c                       c              c                            a     u   a  ag  aauagaauaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 677525-677759 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2655n
mtr-MIR2655ochr7: 677526-677760 [+]
mtr-MIR2655nchr7: 677525-677759 [-]
Database links

Mature sequence mtr-miR2655n

Accession MIMAT0013453
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).