Stem-loop sequence mtr-MIR2655o

AccessionMI0012001 (change log)
DescriptionMedicago truncatula miR2655o stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -            a  ag  g                       g        a                                        a   u  uc  uu  -cu    u 
5'  cucauaaguaau aa  gu cguuuaggucccuuaacuuuauu aaaguauc guuugguccuuucuguuaauuuaauucaaaaaaauguuaa uuu gg  cc  au   uauu a
    |||||||||||| ||  || ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||  ||  ||   |||| a
3'  ggguauucauua uu  ca gcaaauccagggaauugaaauaa uuucauag caaacuaggaaagacaauuaaauuaaguuuuuuugcaauu aaa cc  gg  ug   auga u
   a            c  ga  g                       a        c                                        g   u  cu  uu  auu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 677526-677760 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2655o
mtr-MIR2655nchr7: 677525-677759 [-]
mtr-MIR2655ochr7: 677526-677760 [+]
Database links

Mature sequence mtr-miR2655o

Accession MIMAT0013454
Sequence

21 - 

cguuuaggucccuuaacuuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).