Stem-loop sequence mtr-MIR2656b

AccessionMI0012003 (change log)
DescriptionMedicago truncatula miR2656b stem-loop
Gene family MIPF0000976; MIR2656
Stem-loop
   ---acau    a aaga    ua    -gc    u   -gu   ag     -      g     aaga 
5'        gcau u    gguc  aguu   auaa cga   ugg  ucgca uuuguc aguca    u
          |||| |    ||||  ||||   |||| |||   |||  ||||| |||||| |||||     
3'        cgug a    uuag  ucaa   uauu guu   guu  agugu gaauag uuagu    g
   aguaaau    a ---g    ua    aca    u   aau   ga     u      -     auuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 13877779-13877906 [+]
intergenic
Database links

Mature sequence mtr-miR2656b

Accession MIMAT0013456
Sequence

20 - 

aaguugcauaaucgaguugg

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).