Stem-loop sequence mtr-MIR2657

AccessionMI0012004 (change log)
DescriptionMedicago truncatula miR2657 stem-loop
Stem-loop
   c   auuccuug   uu   g    a        ----     aaauuucaaguuauugugcaagcaagaagugugacuccaaggggaagauaccaauuuggagaacugcaauggacaaauggaaaacaca 
5'  cag        aca  caa aaaa uggugaaa    agaag                                                                                        u
    |||        |||  ||| |||| ||||||||    |||||                                                                                         
3'  guc        ugu  guu uuuu gcuacuuu    ucuuc                                                                                        u
   u   guuguuca   -u   g    a        auug     guaugaucauauuagguuauuaugguguaauuuagguugauaaaccuuauuagaaaguaaacgcaacuugucauugcccugaggaaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 23479463-23479721 [-]
intergenic
Database links

Mature sequence mtr-miR2657

Accession MIMAT0013457
Sequence

222 - 

uguuauuucaucgauuuuguug

 - 243

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).