Stem-loop sequence mtr-MIR2658

AccessionMI0012006 (change log)
DescriptionMedicago truncatula miR2658 stem-loop
Stem-loop
   a    ug c uu    -a    c   --      ----a   auau ug   uaa    u 
5'  aaug  a c  guau  ugau ugg  aaggag     gaa    u  aua   gauu u
    ||||  | |  ||||  |||| |||  ||||||     |||    |  |||   ||||  
3'  uuac  u g  ugua  acua acc  uuccuc     cuu    g  uau   uuaa a
   a    gu u uu    aa    a   aa      accaa   gucu gu   -ua    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 40662275-40662388 [-]
intergenic
Database links

Mature sequence mtr-miR2658

Accession MIMAT0013459
Sequence

3 - 

augugaccuuguauaugauc

 - 22

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).