Stem-loop sequence mtr-MIR2659e

AccessionMI0012011 (change log)
DescriptionMedicago truncatula miR2659e stem-loop
Gene family MIPF0000830; MIR2659
Stem-loop
   a   a    aaaucaa   c    --       c    g     ucuucaucaaauauggauauagauacuccagcauaugaaaucaaaggaagaacuauguc 
5'  ucu cuuc       ugg aucu  ucaaguu ugcu guggu                                                           u
    ||| ||||       ||| ||||  ||||||| |||| |||||                                                           a
3'  aga gaag       auc uaga  gguucag gugg uacca                                                           u
   a   c    ----aac   u    au       c    g     cucaaucucuucacuuuaggugaccuaaaaggcgaacuuacuaauugaggauaaggagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 11639258-11639460 [-]
intergenic
Database links

Mature sequence mtr-miR2659e

Accession MIMAT0013464
Sequence

165 - 

ccaugggugcgacuugguaag

 - 185

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).