Stem-loop sequence mtr-MIR2660

AccessionMI0012013 (change log)
DescriptionMedicago truncatula miR2660 stem-loop
Stem-loop
   a      c  c               uuuc 
5'  guaaga au agcuauaagcuaguu    a
    |||||| || |||||||||||||||    g
3'  cauuuu ua ucgauauucgaucga    c
   c      -  u               cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 9445467-9445528 [-]
intergenic
Database links

Mature sequence mtr-miR2660

Accession MIMAT0013466
Sequence

3 - 

uaagacaucagcuauaagcua

 - 23

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).