Stem-loop sequence mtr-MIR2661

AccessionMI0012015 (change log)
DescriptionMedicago truncatula miR2661 stem-loop
Stem-loop
   guag    -u  -au    c                          auucauu   -a     ---ga   u 
5'     cuuc  ug   uuug aauagguuugagaaaaugggcaguuc       aga  ugaga     gac a
       ||||  ||   |||| ||||||||||||||||||||||||||       |||  |||||     ||| u
3'     gaag  gc   aaac uuaucuagacucuuuuaccuguuaag       ucu  acucu     cug u
   ccaa    uu  cac    a                          ---auuu   ga     aaaaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 18890004-18890141 [+]
intergenic
Database links

Mature sequence mtr-miR2661

Accession MIMAT0013468
Sequence

21 - 

uagguuugagaaaaugggcag

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).