Stem-loop sequence mtr-MIR2662

AccessionMI0012016 (change log)
DescriptionMedicago truncatula miR2662 stem-loop
Stem-loop
   ----------------------------------------------------------uuucauuucacauuuucauuuucaccaaa        acc     aaa      -u     uauguaagaaauguaaaauaccaagauuuuaucauucuauaaaaguucaaguagcacauaaauacauuuuugaaauaaaaa 
5'                                                                                        caacauag   aaaua   aauuaa  ucuau                                                                                 g
                                                                                          ||||||||   |||||   ||||||  |||||                                                                                 c
3'                                                                                        guuguauu   uuugu   uuaauu  agaua                                                                                 a
   auaagccaaguguaaaaaugaguuggcguaccaaaccaaaccaaacgccgaaaguaaaaugguuggcuugguaugguuugguuuggc        auu     -ga      uu     caguggaucugguuaugauuaucuuugaguuaccuuugaaaauauuuuacuguauaaacaagagaacaauucaaagaagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 20744212-20744554 [-]
intergenic
Database links

Mature sequence mtr-miR2662

Accession MIMAT0013469
Sequence

322 - 

gaguaaaaaugugaaccgaau

 - 342

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).