Stem-loop sequence mtr-MIR2663

AccessionMI0012017 (change log)
DescriptionMedicago truncatula miR2663 stem-loop
Stem-loop
   -      aa  aau    u     gagagggcguuacaauuuuuauggugaugcucg 
5'  cauuaa  au   caaa aauua                                 u
    ||||||  ||   |||| |||||                                 g
3'  guaauu  ug   guuu uuagu                                 g
   g      gg  -gu    -     gguaauugguaguguuuucaggugguggugggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 10589879-10589992 [-]
intergenic
Database links

Mature sequence mtr-miR2663

Accession MIMAT0013470
Sequence

21 - 

uuagagagggcguuacaauu

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).