Stem-loop sequence mtr-MIR2664a

AccessionMI0012018 (change log)
DescriptionMedicago truncatula miR2664a stem-loop
Gene family MIPF0001740; MIR2664
Stem-loop
   ---------uuauaaaaaaaaaaa        u              g               a  a               c    a     a    aucaauuaacgauuuu 
5'                         aguuuaau gugguggguugaca uccaaaacaguuuug ac uacaaucaaucaaaa auuu gaauc ccac                a
                           |||||||| |||||||||||||| ||||||||||||||| || ||||||||||||||| |||| ||||| ||||                 
3'                         ucaaauua caccacucaacugu agguuuugucaaaac ug auguugguuaguuuu uaag cuuag ggug                a
   uaguauuaaccauaaaauaaaaac        c              a               g  c               a    a     c    caaaccagguauacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 22308272-22308492 [-]
intergenic
Database links

Mature sequence mtr-miR2664a

Accession MIMAT0013471
Sequence

21 - 

aauugugguggguugacaguc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).