Stem-loop sequence mtr-MIR2666

AccessionMI0012020 (change log)
DescriptionMedicago truncatula miR2666 stem-loop
Stem-loop
   uugac     guuu   uuaagu     u        uuu     c    -------      cc     ----uc      aauauucuugugcgugugaaagaaucauucccuguuugcuuaauaugugacauauaguugauaucuuaagcuuuuauuuuaaaucuccgauuucuugccauguuguuaauguacuauaugauaauugcaccuauaauu 
5'      cuuuu    aua      uccuu guauuuuc   cuuuu uucu       aaagug  ccagu      ugcaua                                                                                                                                          u
        |||||    |||      ||||| ||||||||   ||||| ||||       ||||||  |||||      ||||||                                                                                                                                          g
3'      gaaaa    ugu      aggaa uauaggag   gaaag aagg       uuuuau  gguua      acguau                                                                                                                                          u
   -cauu     -agu   ---uau     c        --u     c    auacuuu      uu     cuuuuu      aaaugcaaacgcauacacgguuuucauuuaccauuuaaacucauucucuucauauuaacauauacacauacaccuucaacuuaacaaagguuuuugaacguuucuuaguccuuuacaacaggucaucgaauaagucuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 3266952-3267376 [-]
intergenic
Database links

Mature sequence mtr-miR2666

Accession MIMAT0013473
Sequence

387 - 

cgaaagugaggauaucaagga

 - 407

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).