Stem-loop sequence mtr-MIR2668

AccessionMI0012022 (change log)
DescriptionMedicago truncatula miR2668 stem-loop
Stem-loop
   a    --                 c               cguuuaa      guccuuauau 
5'  augg  uuaaauauguauuucau cuugcaauuaggggu       aaauug          u
    ||||  ||||||||||||||||| |||||||||||||||       ||||||          u
3'  uauc  aauuuauacauaaagua gaacguuaaucccca       uuuaac          g
   a    ug                 a               -------      aguccuaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 25640792-25640911 [+]
intergenic
Database links

Mature sequence mtr-miR2668

Accession MIMAT0013475
Sequence

18 - 

uucauccuugcaauuagggguc

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).