Stem-loop sequence mtr-MIR2669a

AccessionMI0012023 (change log)
DescriptionMedicago truncatula miR2669a stem-loop
Gene family MIPF0001781; MIR2669
Stem-loop
   a      a        aaugacuuuucuggugaagucaacacuauaguauuaaa 
5'  ugguga auuaugag                                      a
    |||||| ||||||||                                       
3'  acuacu ugauacuu                                      g
   a      a        cugacuugaaauauuugucaccccacgaugagugaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 22210698-22210807 [-]
intergenic
Database links

Mature sequence mtr-miR2669a

Accession MIMAT0013476
Sequence

84 - 

aaaguucagucuucauaguauc

 - 105

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).