Stem-loop sequence mtr-MIR399q

AccessionMI0012024 (change log)
DescriptionMedicago truncatula miR399q stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399q
(22 sentences)

Stem-loop
   g     a  u             ua               auaaugggugguugcuaguuuauuuuacaucuauauuaaaauuuua 
5'  uaagc aa cauucaaagggca  ucuccuuuggcaggu                                              u
    ||||| || |||||||||||||  |||||||||||||||                                               
3'  auucg uu gugaguuucucgu  agaggaaaccguuca                                              g
   g     a  u             cg               acaaaugguacuaucaaaaaaaauaaaaaauaaacuauuuauuugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 30126820-30126993 [+]
intergenic
Database links

Mature sequence mtr-miR399q

Accession MIMAT0013477
Sequence

138 - 

ugccaaaggagagcugcucuu

 - 158

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).