Stem-loop sequence mtr-MIR2670a

AccessionMI0012025 (change log)
DescriptionMedicago truncatula miR2670a stem-loop
Gene family MIPF0000855; MIR2670
Stem-loop
   -agugaucaaacuuuuuugggguaaaauagugaguagccgauuuggugaagug       auucuga              -        ---      -u    ---           
5'                                                      aucaacc       uaaguuuaaaucug uuuuuuuu   uacucc  gaaa   cuuuuuacca 
                                                        |||||||       |||||||||||||| ||||||||   ||||||  ||||   ||||||||| u
3'                                                      uaguugg       auuuaaauuuagac aaaaaaaa   augggg  cuuu   ggaaaauggg 
   cacuuuaguagaaccccauuuuaucacucguuggaagaacuccuuuuauggag       gaacccg              c        aau      uu    uua           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 24709014-24709241 [+]
intergenic
Database links

Mature sequence mtr-miR2670a

Accession MIMAT0013478
Sequence

189 - 

caagaagguugcucacuauuu

 - 209

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).