Stem-loop sequence mtr-MIR2670b

AccessionMI0012026 (change log)
DescriptionMedicago truncatula miR2670b stem-loop
Gene family MIPF0000855; MIR2670
Stem-loop
   u      a    uuc   a                 ga   a     -----  g       a     a         a    -cua     -       -   ---a           
5'  gaucaa cuuc   ggg uaaaauagugaguagcu  cuu gggaa     gu aucgacc uuggg uaaguuuaa ucug    uuuuu uacucca uaa    cuuuuuaccg 
    |||||| ||||   ||| |||||||||||||||||  ||| |||||     || ||||||| ||||| ||||||||| ||||    ||||| ||||||| |||    ||||||||| u
3'  uuaguu gaag   ccc auuuuaucacucguugg  gaa cucuu     ua ugguugg aaccc auuuaaauu agac    aaaaa auggggu guu    gaaaaauggg 
   -      a    -ua   c                 aa   c     uuaug  g       g     g         c    caaa     u       u   cuua           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 23357485-23357708 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2670b
mtr-MIR2670bchr4: 23357485-23357708 [-]
mtr-MIR2592afchr4: 23356390-23356624 [-]
Database links

Mature sequence mtr-miR2670b

Accession MIMAT0013479
Sequence

185 - 

caagaagguugcucacuauuu

 - 205

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).