Stem-loop sequence mtr-MIR2670c

AccessionMI0012027 (change log)
DescriptionMedicago truncatula miR2670c stem-loop
Gene family MIPF0000855; MIR2670
Stem-loop
   u     uac     c    -c               ga         -----  g        cua  a           -uu          ---     --    -       - c 
5'  gauca   uucuu gggg  aaauagugaguagcc  uuuggggaa     gu aucaaccc   gg uaaguuuaaau   guuuuuuuua   cccca  gaga cuuuuua c g
    |||||   ||||| ||||  |||||||||||||||  |||||||||     || ||||||||   || |||||||||||   ||||||||||   |||||  |||| ||||||| |  
3'  cuggu   aagaa cccc  uuuaucacucguugg  gaacuccuu     ua uaguuggg   cc auuuaaauuua   caagaaaaau   ggggu  uucu gaaaaau g u
   -     cga     -    au               aa         uuaug  g        aac  g           uac          aug     uc    a       c g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 10276042-10276263 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2670c
mtr-MIR2670cchr5: 10276042-10276263 [+]
mtr-MIR168cchr5: 10278669-10278794 [+]
Database links

Mature sequence mtr-miR2670c

Accession MIMAT0013480
Sequence

183 - 

caagaagguugcucacuauuu

 - 203

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).