Stem-loop sequence mtr-MIR2670d

AccessionMI0012028 (change log)
DescriptionMedicago truncatula miR2670d stem-loop
Gene family MIPF0000855; MIR2670
Stem-loop
   u  uc      cuuc                     ga   a      -----ua       c     a           --aucc      aa    -c    ---ac          
5'  ga  aaucuu    gggguaaaauagugaguagcc  cuu gggaag       aucaacc uuggg uaaguuuaaau      uuuuuu  accc  agaa     uuuuuaccg 
    ||  ||||||    |||||||||||||||||||||  ||| ||||||       ||||||| ||||| |||||||||||      ||||||  ||||  ||||     |||||||| u
3'  cu  uuagaa    ccccauuuuaucacucguugg  gaa cccuuu       uaguugg aacuc auuuaaauuua      aaaaaa  uggg  ucuu     aaaaauggu 
   -  uu      -aca                     aa   c      uauguag       u     g           gaccaa      aa    cu    cuaau          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 3203936-3204159 [+]
intergenic
Database links

Mature sequence mtr-miR2670d

Accession MIMAT0013481
Sequence

185 - 

caagaagguugcucacuauuu

 - 205

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).