Stem-loop sequence mtr-MIR2671j

AccessionMI0012029 (change log)
DescriptionMedicago truncatula miR2671j stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   u       -uuacuuuuu   uc  uu   uu          uuc   uu g 
5'  ggcuuaa          ugg  cc  aac  aauuuuuggu   guu  g u
    |||||||          |||  ||  |||  ||||||||||   |||  |  
3'  uuggguu          acc  gg  uug  uugaaaauua   caa  c u
   -       uuuauucaau   cu  cu   cu          --u   uu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 243605-243706 [+]
intergenic
Database links

Mature sequence mtr-miR2671j

Accession MIMAT0013482
Sequence

63 - 

uuaaaaguuucguuucggucc

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).