Stem-loop sequence mtr-MIR2671a

AccessionMI0012030 (change log)
DescriptionMedicago truncatula miR2671a stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -       -   u                   c    c      a                   a                                                          ca                         -guu        a   c   acucuaauac 
5'  uucguuu ggu ccuuaacuauuaaaaguuu guuu gguccc uaauuuauuuuuugguuuc uuuuggucccuuaacuauuaaaaguuucguuuugguccuuuaacuuacuuuuugguuu  uuuuggucccuuaacuuauuuuuug    ucauuuug ucc uua          a
    ||||||| ||| ||||||||||||||||||| |||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||    |||||||| ||| |||          u
3'  aagcaaa cca ggaauugauaauuuucaaa caaa ccaggg auugaaugaaaaaccaaag aaaaccagggaauugauaauuuucaaagcaaaaccaggaaauugaaugaaaaaccaaa  aaaaccagggaauugaguaggagac    ggugaaac agg aau          u
   a       a   u                   a    a      a                   c                                                          ac                         aguu        c   a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 19714431-19714790 [-]
intergenic
Database links

Mature sequence mtr-miR2671a

Accession MIMAT0013483
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).