Stem-loop sequence mtr-MIR2671b

AccessionMI0012031 (change log)
DescriptionMedicago truncatula miR2671b stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                                   c      a            g      c                                      c                                              -auu  a         c   acucuaauac 
5'  ucguuuuggucccuuaacuauuaaaaguuucguuu gguccc uaauuuauuuuu gguuuu uuuuggucccuuaacuauuaaaaguuucguuuuggucc uuaacuuauuuuuugguuucguuuuggucccuuaacuuauuuuuug    uc uuuuggucc uua          a
    ||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    || ||||||||| |||          u
3'  agcaaaaccagggaauugauaauuuucaaagcaaa ccaggg auugaaugaaaa ccaaaa aaaaccggggaauugauaauuuucgaagcaaaaccagg aauugaaugaaaagccaaagcaaaaccagggaauugaguaggaggc    gg gaaaucagg aau          u
   a                                   a      a            a      c                                      c                                              aguu  g         a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 22898470-22898828 [-]
intergenic
Database links

Mature sequence mtr-miR2671b

Accession MIMAT0013484
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).