Stem-loop sequence mtr-MIR2671c

AccessionMI0012032 (change log)
DescriptionMedicago truncatula miR2671c stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -        a                          c      a            g      c                                                                             a       -guu       a    c   acucuaauac 
5'  ucguuuug uuccuuaacuauuaaaaguuucguuu gguccc uaacuuauuuuu gguuuu uuuuggucccuuaacuauuaaaaguuuuguuuuggucuuuuaacuuacuuuuugguuucguuuuggucccuuaacuu uuuuuug    ucauuuu gucc uua          a
    |||||||| |||||||||||||||||||||||||| |||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    ||||||| |||| |||          u
3'  agcaaaac agggaauugauaauuuucaaagcaaa ccaggg auugaaugaaaa ccaaag aaaaccagggaauugauaauuuucaaagcaaaaccagaaaauugaaugaaaaaccaaagcaaaaccagggaauugag aggaagc    ggugaaa cagg aau          u
   a        c                          a      a            a      c                                                                             a       aguu       c    a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16668115-16668473 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2671c
mtr-MIR395jchr5: 16671143-16671218 [-]
mtr-MIR2671cchr5: 16668115-16668473 [-]
Database links

Mature sequence mtr-miR2671c

Accession MIMAT0013485
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).