Stem-loop sequence mtr-MIR2671d

AccessionMI0012033 (change log)
DescriptionMedicago truncatula miR2671d stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                              c    c      a            g      c                            g         c                                      au          --  a         c   acucuaauac 
5'  ucguuuugguuccuuaacuauuaaaaguuu guuu gguccc uaacuuauuuuu gguuuu uuuuggucccuuaacuauuaaaaguuuc uuuuggucc uuaacuuauuuuuugguuucguuuuggucccuuaacuu  uuuuuuuguu  uc uuuuggucc uua          a
    |||||||||||||||||||||||||||||| |||| |||||| |||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||  ||||||||||  || ||||||||| |||          u
3'  agcaaaaccagggaauugauaauuuucaaa caaa ccaggg auugaaugaaaa ccaaag aaaaccagggaauugauaauuuucaaag aaaaccagg aauugaaugaaaaaccaaaguaaaaccagggaauugag  aaggaagcag  gg gaaaccagg aau          u
   a                              a    a      a            a      u                            a         a                                      --          uc  a         a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 22261365-22261724 [+]
intergenic
Database links

Mature sequence mtr-miR2671d

Accession MIMAT0013486
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).