Stem-loop sequence mtr-MIR2671e

AccessionMI0012034 (change log)
DescriptionMedicago truncatula miR2671e stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   ---------------------------------                              c      a            g      c                            a         c                                             u   --  a         c   acucuaauac 
5'                                  uuggucccuuaacuauuaaaaguuucguuu gguccc uaacuuauuuuu gguuuu uuuuggucccuuaacuauuaaaaguuuc uuuuggucc uugacuuauuuuuugguuucguuuuggucucuuaacuuauuuuuu guu  uc uuuuggucc uua          a
                                    |||||||||||||||||||||||||||||| |||||| |||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||  || ||||||||| |||          u
3'                                  aaccagggaauugauaauuuucaaagcaaa ccaggg auugaaugaaaa ccaaag aaaaccagggaauugauaauuuucgaag aaaaccagg aauugaaugaaaaaccaaagcaaaaccagggaauugaguaggagg cag  gg gaaacuagg aau          u
   aaaaccagggaauugaauaaaaaaucaaagcaa                              a      a            a      c                            c         c                                             -   uu  a         a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 41342486-41342866 [+]
intergenic
Database links

Mature sequence mtr-miR2671e

Accession MIMAT0013487
Sequence

16 - 

uuaaaaguuucguuucggucc

 - 36

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).