Stem-loop sequence mtr-MIR2671f

AccessionMI0012035 (change log)
DescriptionMedicago truncatula miR2671f stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -             u                     c      a            g      c                                      c              a                       a          --            c   acucuauugc 
5'  ucguuuugguucc uaacuauuaaaaguuucguuu gguccc uaacuuauuuuu gguuuu uuuuggucccuuaacuauuaaaaguuucguuuuggucc uuaacuuauuuuuu guuucguuuugguccuuuaacuu uuuuuugguu  ucauuuuggucc uua          a
    ||||||||||||| ||||||||||||||||||||| |||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||  |||||||||||| |||          u
3'  aguaaaaccaggg auugauaauuuucaaagcaaa ccaggg auugaaugaaaa ccaaag aaaaccagggaauugauaauuuucaaagcaaaaccagg aauugaaugaaaaa caaagcaaaaccagggaauugag aaggagccag  ggugaaaccagg aau          u
   a             u                     a      a            a      c                                      a              c                       -          uu            a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 42437335-42437693 [-]
intergenic
Database links

Mature sequence mtr-miR2671f

Accession MIMAT0013488
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).