Stem-loop sequence mtr-MIR2671g

AccessionMI0012036 (change log)
DescriptionMedicago truncatula miR2671g stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                                   c      a            ga     c                                 a    c              u                c       a      g   -u -          c   acucuaauac 
5'  ucguuuugguuccuuaacuauuaaaaguuucguuu gguccc uaauuuauuuuu  guuuu uuuuggucccuuaacuauuaaaaguuucguuuu gucc uuaacuuauuuuuu gguuucguuuuggucc uuaacuu uuuuuu guu  c auuuuggucc uua          a
    ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||  ||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||| ||||||| |||||| |||  | |||||||||| |||          u
3'  agcaaaaccagggaauugauaauuuucaaagcaaa ccaggg auugaaugaaaa  caaag aaaaccagggaauugauaauuuucaaagcaaaa cagg aauugaaugaaaaa cuaaagcaaaaccagg aauugag aaggag cag  g ugaaaccagg aau          u
   c                                   a      a            ac     c                                 c    a              -                u       -      g   uu a          a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 7256648-7257007 [+]
intergenic
Database links

Mature sequence mtr-miR2671g

Accession MIMAT0013489
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).