Stem-loop sequence mtr-MIR2671h

AccessionMI0012037 (change log)
DescriptionMedicago truncatula miR2671h stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   ucguuuugguuccuuaacuauuaaaaguuucguuucggucccauaacuuauuuuuugguuucauuuuggucccuuaacuauuaaaaguuuc                              c                          -guu            c   acucuaauac 
5'                                                                                            guuuugguccuuuaacuuacuuuuugguuu guuuuggucccuuaacuuauuuuuug    ucauuuuggucc uua          a
                                                                                              |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    |||||||||||| |||          u
3'                                                                                            caaaacuaggaaauugaaugaaaaaccaaa caaaaccagggaauugaguaggagac    ggugaaaccagg aau          u
   ----------------------------aagcaaaaccauggaauugauaauuuucaaagcaaaaccagggaauugaaugaaaaaccaaag                              a                          aguu            a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 46468156-46468485 [+]
intergenic
Database links

Mature sequence mtr-miR2671h

Accession MIMAT0013490
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).